Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22064433

Morpholino Name: kmt2d MO2
Synonyms:
mRNA Target: kmt2d

Morpholino Type: splice blocking morpholino
Sequence:
5' TATCGCCAAACATACCTCCTCTCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14978:3504961..3504985 25/25 unknown
Publications
First: Loss of function of Kmt2d, a gene mutated in Kabuki syndrome, affects heart development in Xenopus laevis., Dev Dyn 2019                    
Most recent: The histone methyltransferase KMT2D, mutated in Kabuki syndrome patients, is required for neural crest cell formation and migration., Hum Mol Genet 2020                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556