Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22064775

Morpholino Name: prdx1 MO1
Synonyms:
mRNA Target: prdx1

Morpholino Type: uncategorized morpholino (ATG)
Sequence:
5' ATGTCTGCCGGAAACGCAAAAATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold325141:708938..708962 25/25 Sense off-target Xelaev16043042m
Publications
First: Peroxiredoxin1, a novel regulator of pronephros development, influences retinoic acid and Wnt signaling by controlling ROS levels., Sci Rep 2017                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556