Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22064785

Morpholino Name: wnt8a MO7
Synonyms:
mRNA Target: wnt8a

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCTTTTCATGGTGAAGGCTGATAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Roles of two types of heparan sulfate clusters in Wnt distribution and signaling in Xenopus., Nat Commun 2017                                                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556