Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22065350

Morpholino Name: otx1 MO2
Synonyms:
mRNA Target: otx1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGACATCATGCTCAAGGCTGGACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' TGTCCAGCCTTGAGCATGATGTCAT 3' ||||||||||||||||||||||||| 3' ACAGGTCGGAACTCGTACTACAGTA 5' 5' TATCCAGCCTTGAGCATGATGTCCT 3' | ||||||||||||||||||||| | 3' ACAGGTCGGAACTCGTACTACAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold111824:1407837..1407861 23/25 Antisense off-target Xelaev16002979m
Scaffold12020:6251770..6251794 23/25 Antisense target otx1
Scaffold45965:2196026..2196050 21/25 unknown
tropicalis 7.1 scaffold_5:94039274..94039298 25/25 Antisense target otx1
scaffold_2:32724880..32724904 22/25 unknown
scaffold_2:8168941..8168965 21/25 unknown
scaffold_3:71401324..71401348 21/25 unknown
Publications
First: Endodermal Maternal Transcription Factors Establish Super-Enhancers during Zygotic Genome Activation., Cell Rep 2019                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556