Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22065997

Morpholino Name: crx MO1
Synonyms: otx5 MO
mRNA Target: crx

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' AATGTAGGACATCATTTCAGTGGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Occupancy of tissue-specific cis-regulatory modules by Otx2 and TLE/Groucho for embryonic head specification., Nat Commun 2014        
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556