Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22167811

Morpholino Name: h2az2 MO1
Synonyms: H2AFV MO, H2AFV MO#1
mRNA Target: h2az2

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGGGAACTAAGAGGTACAAAGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold247724:5703976..5704000 25/25 Sense off-target Xelaev16033136m
Scaffold247724:5703976..5704000 25/25 Antisense off-target Xelaev16033135m
Scaffold409144:655232..655256 25/25 Antisense off-target h2afv
Scaffold24235:1559791..1559815 21/25 unknown
Scaffold45996:77647..77671 21/25 unknown
tropicalis 7.1 scaffold_3:106130602..106130626 21/25 Sense off-target reln
scaffold_4:28280548..28280572 21/25 unknown
Publications
First: Single Amino Acid Change Underlies Distinct Roles of H2A.Z Subtypes in Human Syndrome., Cell 2019                                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556