Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22169651

Morpholino Name: vldlr cMO1
Synonyms:
Target mRNA: vldlr

Morpholino Type: control morpholino
Sequence: 5' GATGGGAGTGTGATGGAGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

MO
5' GTCTCCATCACACTCCCATC 3' |||||||||||||||||||| 3' CAGAGGTAGTGTGAGGGTAG 5' 5' GTCTCCATCACACTCCCATC 3' |||||||||||||||||||| 3' CAGAGGTAGTGTGAGGGTAG 5' 5' GTCTCCATCACACTCCCATC 3' |||||||||||||||||||| 3' CAGAGGTAGTGTGAGGGTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold58:256297..256316 20/20 Sense target vldlr.S
chr1L:126334050..126334069 20/20 Sense target vldlr.L
chr1S:6953837..6953856 18/20 Antisense off-target Xelaev18008818m
chr4S:26387531..26387550 18/20 Antisense off-target Xelaev18024704m
chr4S:26387531..26387550 18/20 Antisense off-target LOC108715348
chr3L:85782392..85782411 17/20 Sense off-target LOC108711340 [provisional:duox1]
chr5S:48970382..48970401 17/20 Sense off-target LOC108717885 [provisional:map3k5]
chr3S:43210774..43210793 16/20 Antisense off-target LOC108712842
chr3S:43210774..43210793 16/20 Antisense off-target aen.S
Scaffold24:2712620..2712639 19/20 unknown
chr2L:178920111..178920130 19/20 unknown
chr2L:178920243..178920262 19/20 unknown
chr4S:107043606..107043625 19/20 unknown
chr9_10S:7856124..7856143 19/20 unknown
chr9_10S:7856269..7856288 19/20 unknown
Scaffold42066:440..459 18/20 unknown
chr1S:5680089..5680108 18/20 unknown
chr4S:107043426..107043445 18/20 unknown
chr5S:100501388..100501407 18/20 unknown
chr6L:132332735..132332754 17/20 unknown
Scaffold38903:129..148 16/20 unknown
chr2S:19323156..19323175 16/20 unknown
chr4S:16421941..16421960 16/20 unknown
chr6S:83584163..83584182 16/20 unknown
chr7L:58855498..58855517 16/20 unknown
tropicalis 10.0 Chr1:128081143..128081162 20/20 Sense target vldlr
Chr6:16055842..16055861 19/20 Sense off-target dpp6
Chr5:58932370..58932389 17/20 Sense off-target map3k5
Chr8:72077031..72077050 17/20 Sense off-target wdr46
Chr2:3732756..3732775 18/20 unknown
Publications
First: The VLDL receptor regulates membrane progesterone receptor trafficking and non-genomic signaling., J Cell Sci 2018                  
Most recent:
View All Papers