Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22169884

Morpholino Name: trpm8 MO1
Synonyms: TRPM8-tbMO1
mRNA Target: trpm8

Morpholino Type: translation blocking morpholino
Sequence:
5' ATGGTCTGACAGTCATTGTAAAGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AGCTTTACAATGACTGTCAGACCCA 3' ||||||||||||||||||||||| 3' TCGAAATGTTACTGACAGTCTGGTA 5' 5' AGCTTTACAATGACTGTCAGACCAT 3' ||||||||||||||||||||||||| 3' TCGAAATGTTACTGACAGTCTGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:73044114..73044138 25/25 Antisense target trpm8.L
chr3S:31850289..31850313 21/25 unknown
chr3S:79856330..79856354 21/25 unknown
tropicalis 10.0 Chr9:59513029..59513053 23/25 Antisense target trpm8
Publications
First: Growth at Cold Temperature Increases the Number of Motor Neurons to Optimize Locomotor Function., Curr Biol 2019                  
Most recent:
View All Papers