Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22169885

Morpholino Name: trpm8 MO2
Synonyms: TRPM8-tbMO2
mRNA Target: trpm8

Morpholino Type: translation blocking morpholino
Sequence:
5' CTGCTGACACCCTTTGTATCTCTAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr4:100257687..100257711 21/25 Antisense off-target rgs16
Publications
First: Growth at Cold Temperature Increases the Number of Motor Neurons to Optimize Locomotor Function., Curr Biol 2019                  
Most recent:
View All Papers