Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22169886

Morpholino Name: trpm8 MO3
Synonyms: TRPM8-sbMO
mRNA Target: trpm8

Morpholino Type: splice blocking morpholino
Sequence:
5' TGACCCTCTATGTGCCTTACTATCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' AGATAGTAAGGCACATGGAGGGTGT 3' |||||||||||||||| |||||| 3' TCTATCATTCCGTGTATCTCCCAGT 5' 5' AGATAGTAAGGCACATAGAGGGTCA 3' ||||||||||||||||||||||||| 3' TCTATCATTCCGTGTATCTCCCAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:73053273..73053297 25/25 Antisense target trpm8.L
Scaffold40:1043259..1043283 21/25 Sense off-target LOC108704587 [provisional:erc2]
tropicalis 10.0 Chr9:59506081..59506105 22/25 Antisense target trpm8
Publications
First: Growth at Cold Temperature Increases the Number of Motor Neurons to Optimize Locomotor Function., Curr Biol 2019                  
Most recent:
View All Papers