Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22194337

Morpholino Name: ncbp2 MO1
Synonyms:
mRNA Target: ncbp2

Morpholino Type: splice blocking morpholino (I1-E2)
Sequence:
5' CGGTTTCCCTAGAATAGAAACAGGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACCTGTTTCTATTCTAGGGAAACCG 3' ||||||||||||||||||||||||| 3' TGGACAAAGATAAGATCCCTTTGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold30987:3368056..3368080 25/25 Antisense target ncbp2
Scaffold34527:8665170..8665194 21/25 Antisense off-target Xelaev16045421m
tropicalis 7.1 scaffold_1:12652965..12652989 21/25 Antisense off-target elovl7
scaffold_2:54385406..54385430 21/25 unknown
Publications
First: NCBP2 modulates neurodevelopmental defects of the 3q29 deletion in Drosophila and Xenopus laevis models., PLoS Genet 2020                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556