Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22194340

Morpholino Name: pak2 MO1
Synonyms:
mRNA Target: pak2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGAGATAAATCCTACCTTTTTCTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' ACAGAAAAAGGTAGGATATATCAGT 3' ||||||||||||||||| |||| | 3' TGTCTTTTTCCATCCTAAATAGAGA 5' 5' ACAGAAAAAGGTAGGATTTATCTCT 3' ||||||||||||||||||||||||| 3' TGTCTTTTTCCATCCTAAATAGAGA 5' 5' ACAGAAAAAGGTAGGATATATCTGT 3' ||||||||||||||||| ||||| | 3' TGTCTTTTTCCATCCTAAATAGAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:128673525..128673549 25/25 Antisense target pak2.L
chr5S:110464294..110464318 23/25 Antisense target pak2.S
chr2L:68362322..68362346 21/25 Antisense off-target pigr.L
chr3S:108954479..108954503 21/25 Antisense off-target irf1.S
chr3S:91123948..91123972 21/25 unknown
chr4L:129264290..129264314 21/25 Sense off-target chchd6.L
chr5S:62958680..62958704 21/25 unknown
chr6L:109044306..109044330 21/25 Antisense off-target lama3.L
chr6L:147872295..147872319 21/25 Antisense off-target fam135b.L
chr7S:20008297..20008321 21/25 Sense off-target btrc.S
tropicalis 10.0 Chr5:129794262..129794286 22/25 Antisense target pak2
Chr9:65121888..65121912 21/25 unknown
Publications
First: NCBP2 modulates neurodevelopmental defects of the 3q29 deletion in Drosophila and Xenopus laevis models., PLoS Genet 2020                          
Most recent:
View All Papers