Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22194340

Morpholino Name: pak2 MO1
Synonyms:
mRNA Target: pak2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGAGATAAATCCTACCTTTTTCTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 23/25
genomic

MO
5' ACAGAAAAAGGTAGGATATATCAGT 3' ||||||||||||||||| |||| | 3' TGTCTTTTTCCATCCTAAATAGAGA 5' 5' ACAGAAAAAGGTAGGATATATCTGT 3' ||||||||||||||||| ||||| | 3' TGTCTTTTTCCATCCTAAATAGAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold44494:3191846..3191870 25/25 Antisense off-target Xelaev16054618m
Scaffold16807:6797413..6797437 23/25 Antisense target pak2
Scaffold13523:8282891..8282915 21/25 unknown
Scaffold1915:332593..332617 21/25 Sense off-target btrc
Scaffold43791:3776229..3776253 21/25 Antisense off-target fam135b
Scaffold48253:5403653..5403677 21/25 Antisense off-target Xelaev16057606m
Scaffold51808:657430..657454 21/25 Antisense off-target Xelaev16059320m
Scaffold5925:3442725..3442749 21/25 unknown
Scaffold8355:2132524..2132548 21/25 unknown
Scaffold85591:1221494..1221518 21/25 Antisense off-target Xelaev16076105m
tropicalis 7.1 scaffold_9:37131136..37131160 22/25 Antisense target pak2
scaffold_9:20769928..20769952 21/25 unknown
Publications
First: NCBP2 modulates neurodevelopmental defects of the 3q29 deletion in Drosophila and Xenopus laevis models., PLoS Genet 2020                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556