Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22201018

Morpholino Name: pou5f3.3 MO8
Synonyms:
mRNA Target: pou5f3.3

Morpholino Type: translation blocking morpholino
Sequence:
5' TACATTGGGTGCAGGGACCCTCTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556