Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22201019

Morpholino Name: sox3 MO5
Synonyms:
Target mRNA: sox3

Morpholino Type: translation blocking morpholino
Sequence: 5' GTCTGTGTCCAACATGCTATACATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 23/25
genomic

MO
5' GATGTATAGCATGTTGGACACAGAC 3' ||||||||||||||||||||||||| 3' CTACATATCGTACAACCTGTGTCTG 5' 5' GATGTATAGCATGTTGGACACAGAC 3' ||||||||||||||||||||||||| 3' CTACATATCGTACAACCTGTGTCTG 5' 5' AATGTATAGCATGTTGGACACCGAC 3' |||||||||||||||||||| ||| 3' CTACATATCGTACAACCTGTGTCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:33820529..33820553 25/25 Antisense target sox3.L
chr8S:61007074..61007098 23/25 Antisense target sox3.S
chr5L:96193784..96193808 21/25 Antisense off-target kbtbd11.L
tropicalis 10.0 Chr8:55347977..55348001 25/25 Antisense target sox3
Publications
First: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
Most recent:
View All Papers