Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22201551

Morpholino Name: mos MO3
Synonyms:
mRNA Target: mos

Morpholino Type: uncategorized morpholino
Sequence:
5' ATCTAGTACAGTATCTCAATGTCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGACATTGAGATACTGTACTAGAT 3' ||||||||||||||||||||||||| 3' ACCTGTAACTCTATGACATGATCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold58038:4054702..4054726 25/25 Sense target mos
Scaffold106356:2146134..2146158 21/25 Sense off-target Xelaev16001563m
Scaffold214452:112364..112388 21/25 unknown
tropicalis 7.1 scaffold_1:106707861..106707885 21/25 Antisense off-target ptplad2
scaffold_2:135503715..135503739 21/25 Sense off-target sh3bgr
scaffold_4:116584294..116584318 21/25 Antisense off-target dock3
Publications
First: Differential phosphorylation controls Maskin association with eukaryotic translation initiation factor 4E and localization on the mitotic apparatus., Mol Cell Biol 2005                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556