Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22201551

Morpholino Name: mos MO3
Synonyms:
Target mRNA: mos

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTAGTACAGTATCTCAATGTCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGACATTGAGATACTGTACTAGAT 3' ||||||||||||||||||||||||| 3' ACCTGTAACTCTATGACATGATCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:116462614..116462638 25/25 Sense target mos.L
chr1L:16762467..16762491 21/25 Sense off-target sorcs2.L
chr1S:104407055..104407079 21/25 unknown
tropicalis 10.0 Chr2:11634712..11634736 21/25 Sense off-target sh3bgr
Chr4:127451597..127451621 21/25 Antisense off-target dock3
Chr1:119860026..119860050 21/25 Antisense off-target hacd4
Publications
First: Differential phosphorylation controls Maskin association with eukaryotic translation initiation factor 4E and localization on the mitotic apparatus., Mol Cell Biol 2005                  
Most recent:
View All Papers