Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22251580

Morpholino Name: gdf6 MO2
Synonyms:
mRNA Target: gdf6

Morpholino Type: translation blocking morpholino
Sequence:
5' GGCTCCTGTATGTATCCATTAGCGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GCGCTAATGGATACATACAGGAGCC 3' |||||||||||||||||||||||| 3' GGCGATTACCTATGTATGTCCTCGG 5' 5' CCGCTAATGGATACATACAGGAGCC 3' ||||||||||||||||||||||||| 3' GGCGATTACCTATGTATGTCCTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:107763533..107763557 25/25 Antisense target gdf6.S
chr6L:131391231..131391255 25/25 Antisense off-target LOC108719358
tropicalis 10.0 Chr6:130144698..130144722 24/25 Antisense target gdf6
Publications
First: Rare heterozygous GDF6 variants in patients with renal anomalies., Eur J Hum Genet 2020                        
Most recent:
View All Papers