Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22251603

Morpholino Name: Hsp90b1 MO1
Synonyms: Grp94 MO
Target mRNA: hsp90b1

Morpholino Type: translation blocking morpholino
Sequence: 5' GACCGATTGCCCAAAACTTCCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' ATGAGGAAGTTTTGGGCAATCGGTC 3' ||||||||||||||||||||||||| 3' TACTCCTTCAAAACCCGTTAGCCAG 5' 5' ATGAGGAAGTCTTGGGCAATCGGTC 3' |||||||||| |||||||||||||| 3' TACTCCTTCAAAACCCGTTAGCCAG 5' 5' ATGAGGAAGTTTTGGGCAATCGGTC 3' ||||||||||||||||||||||||| 3' TACTCCTTCAAAACCCGTTAGCCAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:96047587..96047611 25/25 Antisense target hsp90b1.S
chr3L:42164343..42164367 24/25 Antisense target hsp90b1.L
chr3L:42164343..42164367 24/25 Sense off-target LOC108711023 [provisional:ttc41]
chr6S:84018716..84018740 21/25 unknown
Scaffold26:3580031..3580055 21/25 unknown
tropicalis 10.0 Chr3:49306863..49306887 25/25 Antisense target hsp90b1
Chr6:148183388..148183412 21/25 Sense off-target adgrb1
Publications
First: Grp94 Regulates the Recruitment of Aneural AChR Clusters for the Assembly of Postsynaptic Specializations by Modulating ADF/Cofilin Activity and Turnover., eNeuro 2020              
Most recent:
View All Papers