Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22251604

Morpholino Name: Hsp90ab1 MO1
Synonyms: HSP90β MO
Target mRNA: hsp90ab1

Morpholino Type: translation blocking morpholino
Sequence: 5' CATTGTGGGCAACTTCTGGCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' GATGCCAGAAGTTGCCCACAATG 3' ||||||||||||||||||||||| 3' CTACGGTCTTCAACGGGTGTTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:6197789..6197811 23/23 Antisense target hsp90ab1.S
chr5L:23238217..23238239 22/23 Antisense off-target LOC108716102 [provisional:hsp90ab5p]
chr7S:15657836..15657858 20/23 Sense off-target cyp26c1.S
chr8L:51740546..51740568 20/23 Antisense off-target psmb7.2.L
chr6L:112613211..112613233 19/23 Sense off-target ccdc178.L
chr4S:53891247..53891269 19/23 unknown
chr6L:5887653..5887675 19/23 unknown
chr7L:63765788..63765810 19/23 unknown
chr1L:189133851..189133873 19/23 unknown
chr3S:31947508..31947530 19/23 unknown
chr8L:95157394..95157416 19/23 unknown
tropicalis 10.0 Chr3:112408498..112408520 19/23 unknown
Chr7:115638763..115638785 19/23 unknown
Publications
First: Grp94 Regulates the Recruitment of Aneural AChR Clusters for the Assembly of Postsynaptic Specializations by Modulating ADF/Cofilin Activity and Turnover., eNeuro 2020              
Most recent:
View All Papers