Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22251655

Morpholino Name: spry2 MO3
Synonyms: Sprouty2 MO
Target mRNA: spry2

Morpholino Type: uncategorized morpholino
Sequence: 5' TACTCTGAAGAGTTTTCACACCAGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ACAGGTGTGAAAACTCTTCAGAGTA 3' || |||||||||||||||||||||| 3' TGACCACACTTTTGAGAAGTCTCAT 5' 5' ACTGGTGTGAAAACTCTTCAGAGTA 3' ||||||||||||||||||||||||| 3' TGACCACACTTTTGAGAAGTCTCAT 5' 5' ACTGGTGTGAAAACTCTTCAGAGTA 3' ||||||||||||||||||||||||| 3' TGACCACACTTTTGAGAAGTCTCAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:106936635..106936659 25/25 Antisense target spry2.S
chr2L:124647956..124647980 25/25 Antisense target spry2.L
chr5S:95037434..95037458 21/25 unknown
tropicalis 10.0 Chr2:125076134..125076158 24/25 Antisense target spry2
Publications
First: Sprouty2 regulates positioning of retinal progenitors through suppressing the Ras/Raf/MAPK pathway., Sci Rep 2020                        
Most recent:
View All Papers