Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22251730

Morpholino Name: cfap43 MO1
Synonyms: cfap43 TBMO
mRNA Target: cfap43

Morpholino Type: translation blocking morpholino
Sequence:
5' CAGAGCACAGCCGGAGTTTTCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' GGTTGAAAACTCCGGTTGTGCTCTG 3' | | ||||||||||| ||||||||| 3' CTACCTTTTGAGGCCGACACGAGAC 5' 5' GATGGAAAACTCCGGCTGTGCTCTG 3' ||||||||||||||||||||||||| 3' CTACCTTTTGAGGCCGACACGAGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:38417973..38417997 25/25 Antisense target cfap43.L
chr9_10S:15030229..15030253 21/25 Antisense off-target Xelaev18046260m
chr8L:90079688..90079712 21/25 unknown
tropicalis 10.0 Chr3:45444955..45444979 22/25 Antisense target cfap43
Chr4:106277568..106277592 21/25 unknown
Publications
First: CFAP43 modulates ciliary beating in mouse and Xenopus., Dev Biol 2020                                                                      
Most recent:
View All Papers