Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22251731

Morpholino Name: cfap43 MO2
Synonyms: cfap43 SBMO
mRNA Target: cfap43

Morpholino Type: uncategorized morpholino
Sequence:
5' TATTACTTTAGTCTGCCGGTTTACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGTAAACCGGCAGACTAAAGTAATA 3' ||||||||||||||||||||||||| 3' CCATTTGGCCGTCTGATTTCATTAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:38418005..38418029 25/25 Antisense target cfap43.L
Publications
First: CFAP43 modulates ciliary beating in mouse and Xenopus., Dev Biol 2020                                                                      
Most recent:
View All Papers