Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22252025

Morpholino Name: Sox11 MO3
Synonyms:
Target mRNA: sox11

Morpholino Type: uncategorized morpholino
Sequence: 5' GTGTCACTGCAACGCGGGACTACTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' AAGTAGTCCCGCGTTGCAGTGACAG 3' |||||||||||||||||||||||| 3' TTCATCAGGGCGCAACGTCACTGTG 5' 5' AAGTAGTCCCGCGTTGCAGTGACAG 3' |||||||||||||||||||||||| 3' TTCATCAGGGCGCAACGTCACTGTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:135738457..135738481 24/25 Antisense target sox11.L
chr5S:116852224..116852248 24/25 Antisense target sox11.S
Publications
First: Six1 and Irx1 have reciprocal interactions during cranial placode and otic vesicle formation., Dev Biol 2019                        
Most recent:
View All Papers