Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23619047

Morpholino Name: foxo3 MO2
Synonyms:
Target mRNA: foxo3

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGCTTCTGCCATGCTGCGAGAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 19/23 23/23
genomic

MO
5' GTTCGCGCACCATGGCAGAAGCC 3' ||| |||| |||||||||||| 3' GAAGAGCGTCGTACCGTCTTCGT 5' 5' CTTCTCGCAGCATGGCAGAAGCA 3' ||||||||||||||||||||||| 3' GAAGAGCGTCGTACCGTCTTCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:79617902..79617924 23/23 Antisense target foxo3.L
chr8S:58124946..58124968 20/23 unknown
chr2L:70088487..70088509 19/23 unknown
chr4L:23761201..23761223 19/23 unknown
tropicalis 10.0 Chr5:78348440..78348462 19/23 Antisense target foxo3
Chr5:153184666..153184688 20/23 Antisense off-target efr3b
Chr3:10232957..10232979 19/23 Antisense off-target ddx11
Chr3:31398010..31398032 19/23 Antisense off-target fam13b
Chr5:109544884..109544906 19/23 Antisense off-target tbl1xr1
Chr8:98756182..98756204 19/23 Antisense off-target tdrd9
Chr9:31764247..31764269 19/23 Antisense off-target kdm8
Chr9:31764247..31764269 19/23 Sense off-target brat1
Publications
First: Etv6 activates vegfa expression through positive and negative transcriptional regulatory networks in Xenopus embryos., Nat Commun 2019                                                          
Most recent:
View All Papers