Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23619048

Morpholino Name: foxo3 MO3
Synonyms:
Target mRNA: foxo3

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGCTTCTGCCATGGTGTGTGAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/23 23/23
genomic

MO
5' GTTCGCGCACCATGGCAGAAGCC 3' |||| | |||||||||||||||| 3' CAAGTGTGTGGTACCGTCTTCGG 5' 5' GTTCACACACCATGGCAGAAGCC 3' ||||||||||||||||||||||| 3' CAAGTGTGTGGTACCGTCTTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:60781107..60781129 23/23 Antisense target foxo3.S
chr8S:90143727..90143749 19/23 Antisense off-target setdb1.S
chr5L:95318267..95318289 20/23 unknown
chr9_10L:40147774..40147796 20/23 unknown
chr8L:46923374..46923396 19/23 unknown
chr9_10L:108774914..108774936 19/23 unknown
tropicalis 10.0 Chr5:78348440..78348462 21/23 Antisense target foxo3
Chr1:74970723..74970745 19/23 Antisense off-target tspan5
Chr5:163175242..163175264 19/23 Sense off-target LOC101733761
Chr5:163175360..163175382 19/23 Sense off-target LOC101733761
Publications
First: Etv6 activates vegfa expression through positive and negative transcriptional regulatory networks in Xenopus embryos., Nat Commun 2019                                                          
Most recent:
View All Papers