Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23622432

Morpholino Name: lrp2 MO1
Synonyms:
Target mRNA: lrp2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AGCTCCCATCTCTGTCTCCTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/22 22/22
genomic

MO
5' GCAGGAGACAGAGATGGGAACT 3' ||||||||||||||||||| || 3' CGTCCTCTGTCTCTACCCTCGA 5' 5' GCAGGAGACAGAGATGGGAGCT 3' |||||||||||||||||||||| 3' CGTCCTCTGTCTCTACCCTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:64595170..64595191 22/22 Antisense target lrp2.L
chr2S:120244753..120244774 20/22 Sense off-target Xelaev18015866m
Scaffold19:9512271..9512292 19/22 Antisense off-target grid1.S
chr5S:82109881..82109902 19/22 Sense off-target abcf3.S
chr7L:120365303..120365324 19/22 Antisense off-target igsf21.L
chr8S:92288955..92288976 19/22 Antisense off-target ntrk1.S
Scaffold190:35715..35736 18/22 Antisense off-target LOC108705588 [provisional:tbl1x]
chr1L:167058415..167058436 18/22 Sense off-target kremen1.L
chr1L:68951724..68951745 18/22 Antisense off-target LOC108710879 [provisional:stpg2]
chr1L:91604801..91604822 18/22 Sense off-target antxr2.L
chr1S:109586116..109586137 18/22 Antisense off-target ntrk2.S
chr1S:157273698..157273719 18/22 Sense off-target crhbp.S
chr1S:162628286..162628307 18/22 Antisense off-target parp8.S
chr1S:162696811..162696832 18/22 Sense off-target parp8.S
chr1S:40721994..40722015 18/22 Sense off-target LOC108704322 [provisional:naf1]
chr2S:146196161..146196182 18/22 Sense off-target cntn5.S
chr3L:113506177..113506198 18/22 Antisense off-target LOC108711533 [provisional:tacr1]
chr3L:11368128..11368149 18/22 Antisense off-target tspan9.L
chr3L:64933596..64933617 18/22 Antisense off-target LOC108711168 [provisional:tbc1d22a]
chr3L:6500811..6500832 18/22 Antisense off-target LOC108710765 [provisional:ebf1]
chr4L:115962327..115962348 18/22 Antisense off-target cyth4.L
chr4L:118140530..118140551 18/22 Sense off-target LOC108713678
chr5S:79596666..79596687 18/22 Sense off-target LOC108717438 [provisional:csmd1]
chr6L:46841308..46841329 18/22 Sense off-target rbms3.L
chr6L:68994104..68994125 18/22 Sense off-target LOC108718510 [provisional:ctnnd2]
chr7S:86111203..86111224 18/22 Antisense off-target igsf21.S
chr8L:32323790..32323811 18/22 Antisense off-target diaph2.L
chr9_10S:71956978..71956999 18/22 Antisense off-target bmpr2.S
Scaffold38729:392..413 19/22 unknown
Scaffold82294:191..212 19/22 unknown
chr3L:27316445..27316466 19/22 unknown
chr5S:60363034..60363055 19/22 unknown
chr6L:69162062..69162083 19/22 unknown
chr8L:35022034..35022055 19/22 unknown
chr8S:33961545..33961566 19/22 unknown
chr8S:66433076..66433097 19/22 unknown
Scaffold19:10093502..10093523 18/22 unknown
Scaffold19:4601917..4601938 18/22 unknown
Scaffold21:3882306..3882327 18/22 unknown
Scaffold27:1883538..1883559 18/22 unknown
Scaffold30:1062125..1062146 18/22 unknown
Scaffold86:480466..480487 18/22 unknown
Scaffold94339:100..121 18/22 unknown
chr1L:135540178..135540199 18/22 unknown
chr1L:35556765..35556786 18/22 unknown
chr1L:62960774..62960795 18/22 unknown
chr1L:91220989..91221010 18/22 unknown
chr1S:124333478..124333499 18/22 unknown
chr1S:131838909..131838930 18/22 unknown
chr1S:132177806..132177827 18/22 unknown
chr1S:144009410..144009431 18/22 unknown
chr1S:150778485..150778506 18/22 unknown
chr1S:26837173..26837194 18/22 unknown
chr1S:35342438..35342459 18/22 unknown
chr1S:63578011..63578032 18/22 unknown
chr1S:69311647..69311668 18/22 unknown
chr1S:69682233..69682254 18/22 unknown
chr1S:69749586..69749607 18/22 unknown
chr1S:8219101..8219122 18/22 unknown
chr2L:101148831..101148852 18/22 unknown
chr2L:131954628..131954649 18/22 unknown
chr2L:154532582..154532603 18/22 unknown
chr2L:39375898..39375919 18/22 unknown
chr2L:72489981..72490002 18/22 unknown
chr2S:15612401..15612422 18/22 unknown
chr2S:41482568..41482589 18/22 unknown
chr2S:78922171..78922192 18/22 unknown
chr2S:82028864..82028885 18/22 unknown
chr3L:104235930..104235951 18/22 unknown
chr3L:115477068..115477089 18/22 unknown
chr3L:115540018..115540039 18/22 unknown
chr3L:22007728..22007749 18/22 unknown
chr3L:22817313..22817334 18/22 unknown
chr3L:73796591..73796612 18/22 unknown
chr3S:100706192..100706213 18/22 unknown
chr3S:112724266..112724287 18/22 unknown
chr3S:118219128..118219149 18/22 unknown
chr3S:33125330..33125351 18/22 unknown
chr3S:36936041..36936062 18/22 unknown
chr3S:39696560..39696581 18/22 unknown
chr3S:39879874..39879895 18/22 unknown
chr3S:51641888..51641909 18/22 unknown
chr3S:79793384..79793405 18/22 unknown
chr3S:85799515..85799536 18/22 unknown
chr3S:92573284..92573305 18/22 unknown
chr4L:104806444..104806465 18/22 unknown
chr4L:44810365..44810386 18/22 unknown
chr4L:47404417..47404438 18/22 unknown
chr4L:49305378..49305399 18/22 unknown
chr4L:49453821..49453842 18/22 unknown
chr4L:77517849..77517870 18/22 unknown
chr4S:33471600..33471621 18/22 unknown
chr4S:35843268..35843289 18/22 unknown
chr4S:37568371..37568392 18/22 unknown
chr4S:47636864..47636885 18/22 unknown
chr4S:89614324..89614345 18/22 unknown
chr4S:89830985..89831006 18/22 unknown
chr5L:54040339..54040360 18/22 unknown
chr5L:61365819..61365840 18/22 unknown
chr5L:61373504..61373525 18/22 unknown
chr5L:96579910..96579931 18/22 unknown
chr5S:107080650..107080671 18/22 unknown
chr5S:15583098..15583119 18/22 unknown
chr5S:20060305..20060326 18/22 unknown
chr5S:65871745..65871766 18/22 unknown
chr5S:66820713..66820734 18/22 unknown
chr5S:67702477..67702498 18/22 unknown
chr5S:84016186..84016207 18/22 unknown
chr5S:91357127..91357148 18/22 unknown
chr6L:115866004..115866025 18/22 unknown
chr6L:149711553..149711574 18/22 unknown
chr6L:28585221..28585242 18/22 unknown
chr6L:53677070..53677091 18/22 unknown
chr6L:82881386..82881407 18/22 unknown
chr6L:84985193..84985214 18/22 unknown
chr6S:100053786..100053807 18/22 unknown
chr6S:14245783..14245804 18/22 unknown
chr6S:27485056..27485077 18/22 unknown
chr6S:53507539..53507560 18/22 unknown
chr7L:12434059..12434080 18/22 unknown
chr7L:17275529..17275550 18/22 unknown
chr7L:43985385..43985406 18/22 unknown
chr7L:48325819..48325840 18/22 unknown
chr7L:67012003..67012024 18/22 unknown
chr7L:72869320..72869341 18/22 unknown
chr7L:76706243..76706264 18/22 unknown
chr7L:92195423..92195444 18/22 unknown
chr7S:70874728..70874749 18/22 unknown
chr8L:104793060..104793081 18/22 unknown
chr8L:34321012..34321033 18/22 unknown
chr8L:40768791..40768812 18/22 unknown
chr8S:18121571..18121592 18/22 unknown
chr8S:18551382..18551403 18/22 unknown
chr8S:19495833..19495854 18/22 unknown
chr8S:23883666..23883687 18/22 unknown
chr8S:33170781..33170802 18/22 unknown
chr8S:62366039..62366060 18/22 unknown
chr8S:71582014..71582035 18/22 unknown
chr9_10L:25384074..25384095 18/22 unknown
chr9_10L:61266612..61266633 18/22 unknown
chr9_10L:78281712..78281733 18/22 unknown
chr9_10S:51792099..51792120 18/22 unknown
chr9_10S:54417343..54417364 18/22 unknown
chr9_10S:95879173..95879194 18/22 unknown
tropicalis 10.0 Chr9:68728084..68728105 21/22 Antisense target lrp2
Chr7:35597596..35597617 20/22 Antisense off-target cpn1
Chr7:59302592..59302613 19/22 Antisense off-target LOC100486241
Chr1:144722731..144722752 19/22 Antisense off-target cabp7
Chr5:150823842..150823863 19/22 Sense off-target fam167a
Chr3:51185493..51185514 18/22 Sense off-target LOC100490346
Chr4:1940022..1940043 18/22 Sense off-target LOC100498645
Chr6:92008146..92008167 19/22 unknown
Chr8:35369951..35369972 19/22 unknown
Chr1:20726355..20726376 19/22 unknown
Chr5:72877357..72877378 18/22 unknown
Chr10:25365477..25365498 18/22 unknown
Chr2:102305303..102305324 18/22 unknown
Chr4:101973658..101973679 18/22 unknown
Chr4:2058702..2058723 18/22 unknown
Chr4:81839844..81839865 18/22 unknown
Publications
First: Neural tube closure requires the endocytic receptor Lrp2 and its functional interaction with intracellular scaffolds., Development 2021  
Most recent:
View All Papers