Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23622456

Morpholino Name: anks1a MO1
Synonyms: xanks1a MO
Target mRNA: anks1a

Morpholino Type: uncategorized morpholino
Sequence: 5' AATAACTCCTGTTCTTTCCCCATCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GGATGGGGAAAGAACAGGAGTTATT 3' ||||||||||||||||||||||||| 3' CCTACCCCTTTCTTGTCCTCAATAA 5' 5' GGATGGGGAAAGAACAGGAGTTATT 3' ||||||||||||||||||||||||| 3' CCTACCCCTTTCTTGTCCTCAATAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:51995532..51995556 25/25 Antisense target anks1a.S
chr2L:66007485..66007509 23/25 Antisense off-target LOC733397 [provisional:anks1a]
chr5L:52899040..52899064 21/25 Antisense off-target tmem181.L
chr7L:105668469..105668493 21/25 Sense off-target pax10.L
chr2S:8917103..8917127 21/25 unknown
tropicalis 10.0 Chr2:64310487..64310511 25/25 Antisense target anks1a
Chr6:65836115..65836139 22/25 unknown
Chr10:40583565..40583589 21/25 unknown
Publications
First: The molecular dynamics of subdistal appendages in multi-ciliated cells., Nat Commun 2021                  
Most recent:
View All Papers