Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23659693

Morpholino Name: rspo2 MO5
Synonyms: RMO-ATG
Target mRNA: rspo2

Morpholino Type:
Sequence: 5' AAAGAGTTGAAACTGCATTTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/22 22/22 21/22
genomic

MO
5' CCAAATGCAGTTTCAACTCTTT 3' |||||||||||||||||||||| 3' GGTTTACGTCAAAGTTGAGAAA 5' 5' CCAAATGCAGTTTCAACTCTTT 3' |||||||||||||||||||||| 3' GGTTTACGTCAAAGTTGAGAAA 5' 5' CCAAATGCAGTTTCAACTATTT 3' |||||||||||||||||| ||| 3' GGTTTACGTCAAAGTTGAGAAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:135195196..135195217 22/22 Antisense target rspo2.L
chr6S:111454327..111454348 21/22 Antisense target rspo2.S
chr6S:111454327..111454348 21/22 Antisense off-target LOC108695420
chr1L:2187386..2187407 20/22 Antisense off-target ctnna2.L
chr2S:35260272..35260293 20/22 Antisense off-target col26a1.S
chr3S:31231236..31231257 19/22 Antisense off-target LOC108712776 [provisional:tspan15]
chr6L:50424143..50424164 19/22 Sense off-target cpne4.L
chr8L:47319532..47319553 19/22 Sense off-target LOC108698488
chr9_10L:94443783..94443804 19/22 Sense off-target chst12.L
chr3S:33939224..33939245 18/22 Sense off-target LOC108712786
chr2S:69547807..69547828 20/22 unknown
chr5L:136716332..136716353 20/22 unknown
chr5L:86911343..86911364 20/22 unknown
chr7S:44153933..44153954 20/22 unknown
chr4L:22382907..22382928 19/22 unknown
chr8L:49914416..49914437 19/22 unknown
chr1L:123967101..123967122 18/22 unknown
chr1S:102945684..102945705 18/22 unknown
chr3S:91118012..91118033 18/22 unknown
chr6L:48779323..48779344 18/22 unknown
chr7L:76180292..76180313 18/22 unknown
chr9_10S:14297804..14297825 18/22 unknown
tropicalis 10.0 Chr6:133620412..133620433 22/22 Antisense target rspo2
Chr2:140068598..140068619 19/22 Antisense off-target stac3
Chr3:54344820..54344841 19/22 Antisense off-target cep290
Chr5:100441412..100441433 19/22 Antisense off-target lrch3
Chr5:36844451..36844472 19/22 Sense off-target cfap61
Chr8:86731223..86731244 19/22 Antisense off-target nrde2
Chr1:126017827..126017848 18/22 Antisense off-target ptprd
Chr10:43524185..43524206 18/22 Sense off-target ndrg3
Chr4:132402161..132402182 18/22 Antisense off-target fgd5
Chr9:43210899..43210920 18/22 Sense off-target wipi2
Chr5:137108176..137108197 20/22 unknown
Chr3:97600458..97600479 19/22 unknown
Chr5:78527830..78527851 19/22 unknown
Chr1:188715180..188715201 18/22 unknown
Publications
First: Rspo2 inhibits TCF3 phosphorylation to antagonize Wnt signaling during vertebrate anteroposterior axis specification., Sci Rep 2021              
Most recent:
View All Papers