Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17254191

Xenopus ORFeome
What is the ORFeome?

ORF Name:eef1d.L ORF1 Species: laevis
Gene Symbol: eef1d.L Entrez Gene ID: 399468
Gene Synonyms: gastrula arrested mutant
Gene Name: eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Description: Elongation factor 1 beta/delta chain
Plate: GDExl11025 Well: E08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825127
3' ORF Sequence: JZ830488
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis elongation factor-1 delta, mRNA (cDNA clone MGC:83103 IMAGE:6317612), complete cds
Template Accession: BC068905
GI: 46329748
Clone ID: IMAGE:6317612
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGCTTCTGTCATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATCTTGTTGAAAGCAGCAATGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556