Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17254935

Xenopus ORFeome
What is the ORFeome?

ORF Name:p2ry11.S ORF1 Species: laevis
Gene Symbol: p2ry11.S Entrez Gene ID: 100127246
Gene Synonyms: p2y11
Gene Name: purinergic receptor P2Y, G-protein coupled, 11
Description:
Plate: GDExl11092 Well: F08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839022
3' ORF Sequence: JZ839021
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100127246, mRNA (cDNA clone MGC:181632 IMAGE:8461395), complete cds
Template Accession: BC154961
GI: 159155767
Clone ID: IMAGE:8461395
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_sple_PHA
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCCATCACCTGCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGGGTTGAAAGTCTAGTTTCTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556