Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17255247

Xenopus ORFeome
What is the ORFeome?

ORF Name:ddx21.S ORF1 Species: laevis
Gene Symbol: ddx21.S Entrez Gene ID: 398189
Gene Synonyms: xgu-1
Gene Name: DEAD-box helicase 21
Description: ATP-dependent RNhelicase
Plate: GDExl11040 Well: D05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827613
3' ORF Sequence: JZ827614
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis RNA helicase II/Gu, mRNA (cDNA clone MGC:80743 IMAGE:5512290), complete cds
Template Accession: BC073332
GI: 49119282
Clone ID: IMAGE:5512290
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAATGGGGACACAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGCCCCTTCTAAACC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556