Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17255289

Xenopus ORFeome
What is the ORFeome?

ORF Name:plcg1.S ORF1 Species: laevis
Gene Symbol: plcg1.S Entrez Gene ID: 398360
Gene Synonyms: nckap3, plc gamma 1, plc-ii, plc1, plc148, plcgamma1
Gene Name: phospholipase C gamma 1
Description: Phospholipase C
Plate: GDExl11028 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825582
3' ORF Sequence: JZ825581
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis phospholipase C-gamma-1a, mRNA (cDNA clone MGC:84558 IMAGE:6637883), complete cds
Template Accession: BC070837
GI: 47123192
Clone ID: IMAGE:6637883
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAATCCCTGCCTCTTCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCCGGTTATCCCCACTCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers