Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17255691

Xenopus ORFeome
What is the ORFeome?

ORF Name:LOC494785 ORF1 Species: laevis
Gene Symbol: tsc22d3.S Entrez Gene ID: 494785
Gene Synonyms: dsipi, gilz, tsc-22r
Gene Name: TSC22 domain family member 3
Description: Transcriptional regulator
Plate: GDExl11004 Well: B12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839918
3' ORF Sequence: JZ839917
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC494785, mRNA (cDNA clone MGC:85361 IMAGE:6879163), complete cds
Template Accession: BC082903
GI: 52354652
Clone ID: IMAGE:6879163
Tissue: whole organism
Stage: NF stage 54 to prometamorphosis stage
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCACAGAAATGTGTAACTTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTGCAGAGCCGGCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556