Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17256735

Xenopus ORFeome
What is the ORFeome?

ORF Name:rpsa.L ORF1 Species: laevis
Gene Symbol: rpsa.L Entrez Gene ID: 733335
Gene Synonyms: 37-kd lr, 37lrp, 67-kd lr, lambr, laminin receptor, lamr1, lr, lrp, p40
Gene Name: ribosomal protein SA
Description: 40S ribosomal protein SA (P40)/Laminin receptor 1
Plate: GDExl11088 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838200
3' ORF Sequence: JZ838199
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis 67kD laminin receptor precursor, mRNA (cDNA clone MGC:154332 IMAGE:7391977), complete cds
Template Accession: BC123144
GI: 114108052
Clone ID: IMAGE:7391977
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAGGTCTTGATGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACCATTCAGTAGTGGTTCCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556