Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17256849

Xenopus ORFeome
What is the ORFeome?

ORF Name:sall4.S ORF1 Species: laevis
Gene Symbol: sall4.S Entrez Gene ID: 100337553
Gene Synonyms: drrs, znf797
Gene Name: spalt-like transcription factor 4
Description: zinc finger transcription factor
Plate: GDExl11077 Well: A09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836293
3' ORF Sequence: JZ836294
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:115268 IMAGE:6642867, complete cds
Template Accession: BC095923
GI: 63146276
Clone ID: IMAGE:6642867
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGAGGAGAAAGCAGCCGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTCGTTCCTCAAACTGTGTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556