Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17256939

Xenopus ORFeome

ORF Name:fbxo3.L ORF1 Species: laevis
Gene Symbol: fbxo3.L Entrez Gene ID: 734459
Gene Synonyms:
Gene Name: F-box protein 3
Description: Putative Mg2+ and Co2+ transporter CorD
Plate: GDExl11077 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ836274
3' ORF Sequence: JZ836275
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC115036, mRNA (cDNA clone MGC:115036 IMAGE:6948427), complete cds
Template Accession: BC094171
GI: 62739314
Clone ID: MGC:115036 IMAGE:6948427
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCCGATATATTGAGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGCCTGCCAGGTAAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556