Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17257479

Xenopus ORFeome
What is the ORFeome?

ORF Name:ccno.S ORF1 Species: laevis
Gene Symbol: ccno.S Entrez Gene ID: 734931
Gene Synonyms: ccnu, cyclin-o, udg2, ung2
Gene Name: cyclin O
Description: Cyclin B and related kinase-activating proteins
Plate: GDExl11067 Well: B01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ834420
3' ORF Sequence: JZ834421
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC131046, mRNA (cDNA clone MGC:131046 IMAGE:7980890), complete cds
Template Accession: BC108565
GI: 80476430
Clone ID: IMAGE:7980890
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGACCTGCAGCATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTATCCACATTAATGCTCTTGAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556