Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17257545

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC131121 ORF1 Species: laevis
Gene Symbol: krt18.3.L Entrez Gene ID: 734797
Gene Synonyms:
Gene Name: keratin 18, gene 3
Description:
Plate: GDExl11086 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837918
3' ORF Sequence: JZ837917
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC131121, mRNA (cDNA clone MGC:131121 IMAGE:7983511), complete cds
Template Accession: BC106430
GI: 76780143
Clone ID: IMAGE:7983511
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTCTATGGATCCAATGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGTTTCATTTTCCGGTGGCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556