Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17257593

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC131227 ORF1 Species: laevis
Gene Symbol: lmnb3.S Entrez Gene ID: 734958
Gene Synonyms: lamin b3, lamin liii, lamin-b3, lb3
Gene Name: lamin B3
Description: nucleoskeletal protein
Plate: GDExl11064 Well: D05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833990
3' ORF Sequence: JZ833991
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC108623.1 Xenopus laevis hypothetical protein MGC131227, mRNA (cDNA clone MGC:131227 IMAGE:7390734), complete cds
Template Accession: BC108623
GI: 80479330
Clone ID: IMAGE:7390734
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACGTCCACCCCCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATGGAACAACTGGGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556