Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258031

Xenopus ORFeome
What is the ORFeome?

ORF Name:racgap1.S ORF1 Species: laevis
Gene Symbol: racgap1.S Entrez Gene ID: 379338
Gene Synonyms: cyk-4, id-gap, mgcracgap
Gene Name: Rac GTPase activating protein 1
Description: GTPase-activating protein
Plate: GDExl11012 Well: D10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823984
3' ORF Sequence: JZ829292
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to Rac GTPase activating protein 1, mRNA (cDNA clone MGC:53048 IMAGE:5537502), complete cds
Template Accession: BC046676
GI: 28302186
Clone ID: IMAGE:5537502
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACAAACCTGATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTAGCAGAGGTGAGGCAAAGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556