Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258067

Xenopus ORFeome
What is the ORFeome?

ORF Name:hspd1.L ORF1 Species: laevis
Gene Symbol: hspd1.L Entrez Gene ID: 379341
Gene Synonyms: chaperonin, cpn60, groel, hld4, hsp60, hsp65, spg13
Gene Name: heat shock protein family D (Hsp60) member 1
Description: Mitochondrial chaperonin, Cpn60/Hsp60p
Plate: GDExl11012 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824013
3' ORF Sequence: JZ829321
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to heat shock 60kDa protein 1 (chaperonin), mRNA (cDNA clone MGC:53106 IMAGE:5542413), complete cds
Template Accession: BC046687
GI: 28436901
Clone ID: IMAGE:5542413
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCGGCTACAAAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAAAGCAACTTACCAATTTTCTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers