Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258343

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC53997 ORF1 Species: laevis
Gene Symbol: tubb4b.S Entrez Gene ID: 379202
Gene Synonyms: oocyte tubulin, tubb2, tubb2c, xlot
Gene Name: tubulin beta 4B class IVb
Description: microtubule component
Plate: GDExl11015 Well: E10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ829654
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC043974.1 Xenopus laevis hypothetical protein MGC53997, mRNA (cDNA clone MGC:53997 IMAGE:5571262), complete cds
Template Accession: BC043974
GI: 27695232
Clone ID: IMAGE:5571262
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGAAATCGTACATCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCATTTTCCTCCTCTTCCCCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers