Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258385

Xenopus ORFeome
What is the ORFeome?

ORF Name:p4hb.S ORF1 Species: laevis
Gene Symbol: p4hb.S Entrez Gene ID: 379505
Gene Synonyms:
Gene Name: prolyl 4-hydroxylase subunit beta
Description: collagen synthesis, enzyme subunit
Plate: GDExl11001 Well: E03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839180
3' ORF Sequence: JZ839179
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC64309, mRNA (cDNA clone MGC:64309 IMAGE:6875865), complete cds
Template Accession: BC054954
GI: 32822846
Clone ID: IMAGE:6875865
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCGTGCTAGATTTGTTTTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTCATCTTTTGTATGTACTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556