Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258571

Xenopus ORFeome
What is the ORFeome?

ORF Name:g6pc.L ORF1 Species: laevis
Gene Symbol: g6pc.2.L Entrez Gene ID: 398855
Gene Synonyms: g6pt, gsd1, gsd1a
Gene Name: glucose-6-phosphatase, catalytic subunit, gene 2
Description:
Plate: GDExl11021 Well: B12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824807
3' ORF Sequence: JZ830176
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to glucose-6-phosphatase, mRNA (cDNA clone MGC:68455 IMAGE:3397573), complete cds
Template Accession: BC060354
GI: 37994735
Clone ID: IMAGE:3397573
Tissue: liver
Stage:
Clone Library: NICHD_XGC_Li1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGATGGGGATGGATAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTGACTTTCTTTTTTTGCCACTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.0


Major funding for Xenbase is provided by grant P41 HD064556