Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258763

Xenopus ORFeome
What is the ORFeome?

ORF Name:cd74.L ORF1 Species: laevis
Gene Symbol: cd74.L Entrez Gene ID: 398834
Gene Synonyms:
Gene Name: CD74 molecule
Description: Nidogen and related basement membrane protein proteins
Plate: GDExl11017 Well: F11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824473
3' ORF Sequence: JZ829827
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68635, mRNA (cDNA clone MGC:68635 IMAGE:4032342), complete cds
Template Accession: BC059976
GI: 37747689
Clone ID: IMAGE:4032342
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGAAGAGTCCCAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAAGTGGCCGATGGTCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers