Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258829

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC68706 ORF1 Species: laevis
Gene Symbol: gnas.L Entrez Gene ID: 399059
Gene Synonyms: g alpha s, galphas, gas
Gene Name: GNAS complex locus
Description: G protein subunit Galphas, small G protein superfamily
Plate: GDExl11022 Well: G07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824865
3' ORF Sequence: JZ830236
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC063735.1 Xenopus laevis hypothetical protein MGC68706, mRNA (cDNA clone MGC:68706 IMAGE:4033324), complete cds
Template Accession: BC063735
GI: 39645716
Clone ID: IMAGE:4033324
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTGTCTTGGCAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACAGCTCATATTGGCGCAGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers