Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17258973

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC68885 ORF1 Species: laevis
Gene Symbol: ina.L Entrez Gene ID: 379642
Gene Synonyms: ina-a, inexa, nifa, xefiltin, xina
Gene Name: internexin neuronal intermediate filament protein alpha
Description: structural molecule
Plate: GDExl11019 Well: G03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824529
3' ORF Sequence: JZ829880
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC057721.1 Xenopus laevis hypothetical protein MGC68885, mRNA (cDNA clone MGC:68885 IMAGE:4684133), complete cds
Template Accession: BC057721
GI: 34785888
Clone ID: IMAGE:4684133
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTTCCCTTCGGATCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGTTTCACCAAAGCTTCATCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556