Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17259075

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC69098 ORF1 Species: laevis
Gene Symbol: acat2.L Entrez Gene ID: 379569
Gene Synonyms:
Gene Name: acetyl-CoA acetyltransferase 2
Description: Acetyl-CoA acetyltransferase
Plate: GDExl11020 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824722
3' ORF Sequence: JZ830074
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC056089.1 Xenopus laevis acetyl-CoA acetyltransferase 2, mRNA (cDNA clone MGC:69098 IMAGE:5047328), complete cds
Template Accession: BC056089
GI: 33585700
Clone ID: IMAGE:5047328
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTCAGGAGAGGAAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGGTTCGTTCAACGCACAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers