Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17259081

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC69098 ORF2 Species: laevis
Gene Symbol: acat2.L Entrez Gene ID: 379569
Gene Synonyms:
Gene Name: acetyl-CoA acetyltransferase 2
Description: Acetyl-CoA acetyltransferase
Plate: GDExl11049 Well: D07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831370
3' ORF Sequence: JZ831371
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC074108.1 Xenopus laevis acetyl-CoA acetyltransferase 2, mRNA (cDNA clone MGC:79908 IMAGE:6866536), complete cds
Template Accession: BC074108
GI: 49255962
Clone ID: IMAGE:6866536
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTCAGGAGAGGAAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGGTTCGTTCAACGCACAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers