Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17259519

Xenopus ORFeome
What is the ORFeome?

ORF Name:loc100170420.S ORF1 Species: laevis
Gene Symbol: XB5909790.S [provisional] Entrez Gene ID: 443948
Gene Synonyms: loc100170420, mgc80314, trx1, txn
Gene Name: MGC80314 protein
Description: Thioredoxin
Plate: GDExl11036 Well: E11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826996
3' ORF Sequence: JZ826995
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80314 protein, mRNA (cDNA clone MGC:80314 IMAGE:5073839), complete cds
Template Accession: BC072884
GI: 49119155
Clone ID: IMAGE:5073839
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTCGACACATCGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCAGCGCCTCCACTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers